I was running RNA-seq data through the MarkDuplicates in Picard package for SNP calling getting the message:
WARNING 2016-08-31 16:48:12 AbstractOpticalDuplicateFinderCommandLineProgram A field field parsed out of a read name was expected to contain an integer and did not. Read name: SN1001:449:HGTN3ADXX:1:2115:4606:89966:R2#1#CTCCT. Cause: String 'R2#1#CTCCT' did not start with a parsable number.
Then I run the command:
samtools view resources/HepG2.RBFOX2/HepG2.RBFOX2.rep2.R2.tag.uniq.sorted.bam | grep R2#1#CTCCT
And I got this:
SN1001:449:HGTN3ADXX:2:2110:11231:12370:R2#1#CTCCT 16 chrX 133035777 37 31M * 0 0 TTTTTGAGTTAAAGTTATACACCTGAAGAGG BFFBFB
So I tried to run the command ValidateSamFile
ERROR: Record 2243391, Read name SN1001:449:HGTN3ADXX:1:1207:18758:88057:R2#2#TATAT, NM tag (nucleotide differences) in file [2] does not match reality [6]
ERROR: Record 2500598, Read name SN1001:449:HGTN3ADXX:2:1206:6729:26515:R2#1#TAATC, NM tag (nucleotide differences) in file [3] does not match reality [7]
ERROR: Record 2500599, Read name SN1001:449:HGTN3ADXX:2:2110:7481:90889:R2#1#TTCAG, NM tag (nucleotide differences) in file [3] does not match reality [8]
ERROR: Record 2500601, Read name SN1001:449:HGTN3ADXX:1:1210:6384:54132:R2#1#TAGAT, NM tag (nucleotide differences) in file [3] does not match reality [9]
ERROR: Record 2500602, Read name SN1001:449:HGTN3ADXX:2:2111:15383:87620:R2#1#GGGGG, NM tag (nucleotide differences) in file [3] does not match reality [9]
ERROR: Record 2500603, Read name SN1001:449:HGTN3ADXX:2:2212:9564:100522:R2#1#GGCGC, NM tag (nucleotide differences) in file [3] does not match reality [10]
ERROR: Record 2500604, Read name SN1001:449:HGTN3ADXX:1:2110:14050:67425:R2#1#GGCCC, NM tag (nucleotide differences) in file [2] does not match reality [9]
ERROR: Record 2500605, Read name SN1001:449:HGTN3ADXX:1:2205:20926:12488:R2#1#TCCCC, NM tag (nucleotide differences) in file [1] does not match reality [3]
ERROR: Record 2500606, Read name SN1001:449:HGTN3ADXX:2:2109:8561:77192:R2#1#CCCCC, NM tag (nucleotide differences) in file [1] does not match reality [3]
Does this warning message matters?
