A GATK RUNTIME ERROR has occurred (version 3.1-0-g72492bb):
ERROR ------------------------------------------------------------------------------------------ ERROR stack trace java.lang.ExceptionInInitializerError at...
View ArticleRead the number of expected bins( 65600) but still had more elements in file...
Has this issue (previously reported as https://gatkforums.broadinstitute.org/gatk/discussion/10168/picard-illuminabasecallstosam-clocs-file-issue-more-elements-than-expected ) been fixed? I have just...
View ArticleClik here to view.
Strange distribution of RGQ values
I extracted the RGQ for a sample from 15.5 million non-variant sites of one chromosome and plotted the distribution (I am trying to work out if I can set some thresholds for RGQ for filtering). I get a...
View ArticleRecalculate AF, AC and AN after applying sample/genotype-level filtering
Dear GATK team, I am trying to use VariantFiltration and SelectVariants to mask individual calls with GQ < 20 or DP < 10 in my VCF; however, as I succeed masking individuals who didn't pass the...
View ArticleUnable to use VariantRecalibrator
Hi everyone, I am very new in the field of bioinformatics. Currently, I am working with whole Genome Sequencing Dataset. I am working with mouse data. I am stuck with the VariantRecalibrator steps....
View ArticleGATK4 livestream launch event Tuesday 9 Jan: detailed agenda and speaker lineup
In just a few days, we'll be releasing GATK4 into general availability -- that's right, the big 4.0! To mark the occasion we are hosting a launch event that will be livestreamed on the Broad...
View ArticleClik here to view.
How to judge convergence on BQSR
A nice day to you! Someone said "When the plots of BQSR don't change dramatically, it is convergence." I generated a pdf file afer the command java -Djava.io.tmpdir=/mnt/tmp -jar...
View Articleproblem with picard
Hello, I have been running into an error that i can not figure out why. Here is the error message: Fatal error: Exit code 1 () Picked up _JAVA_OPTIONS:...
View ArticleGetting started with GATK4
GATK, pronounced "Gee Ay Tee Kay" (not "Gat-Kay"), stands for GenomeAnalysisToolkit. It is a collection of command-line tools for analyzing high-throughput sequencing data with a primary focus on...
View ArticleUnknown index type error of SelectVariants
Good day to you! I ran a selectvariant command by nohup java -Xmx5g -jar /home/wuwei/software/GenomeAnalysisTK-3.8-0-ge9d806836/GenomeAnalysisTK.jar -R $referrence -T SelectVariants --variant:VCF...
View ArticleWhy do I see variant calls by haplotype caller with zero reads supporting the...
The example variant call is shown below, 13 28608228 . A AATTTTCTCTTGGAAACTCCCATTTGAGATCATATTCATATTCTCTGAAATCAACGTAGAAGTACTCATTATCTGAGGAGCCGCTCAC 2040.73 ....
View ArticleBest strategy to "fix" the Haplotype Caller - GenotypeGVCF "missing DP field"...
Hi, I've run into the (already reported http://gatkforums.broadinstitute.org/dsde/discussion/5598/missing-depth-dp-after-haplotypecaller ) bug of the missing DP format field in my callings. I've run...
View ArticleIlluminaBasecallsToSam crashing
I have successfully run ExtractIlluminaBarcodes but when I run IlluminaBasecallsToSam on the same data it crashes. I have tried upping both MAX_READS_IN_RAM_PER_TILE and MAX_RECORDS_IN_RAM to no avail....
View ArticleFiltering by sample specific DP thresholds in a multi-sample vcf
Hi I need to filter (set to missing) genotypes that fail their own sample specific DP threshold (from the genotype fields), in a multi-sample vcf. Is there anyway to do this? e.g. sample1 DP<25...
View ArticleJEXL filtering expressions
JEXL stands for Java EXpression Language. It's not a part of the GATK as such; it's a software library that can be used by Java-based programs like the GATK. It can be used for many things, but in the...
View ArticleClik here to view.
Base Quality Score Recalibration (BQSR)
BQSR stands for Base Quality Score Recalibration. In a nutshell, it is a data pre-processing step that detects systematic errors made by the sequencing machine when it estimates the accuracy of each...
View ArticleClik here to view.
Variant Quality Score Recalibration (VQSR)
VQSR stands for Variant Quality Score Recalibration. In a nutshell, it is a sophisticated filtering technique applied on the variant callset that uses machine learning to model the technical profile of...
View ArticleJar caching
Jar caching is a thing you can do to speed up the process of running Spark tools on Google Dataproc. Normally, the GATK engine will start by uploading a copy of the GATK jar file to the cloud, because...
View ArticleJava is using too many resources (threads, memory or CPU)
Most resource allocation problems you run into will be associated with either Spark multithreading or Java. We detail the most common issues as well as the recommended solutions below. These solutions...
View ArticleException in thread "main" java.lang.NoClassDefFoundError:...
This can happen when you run GATK directly from the jar instead of using the gatk-launch script. The gatk-launch script sets an important system property: -Dsnappy.disable=true. You can either set this...
View Article